Information

11.2: Prokaryotic Transcription - Biology

11.2: Prokaryotic Transcription - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

The Lactose Intolerance of Bacteria

The standard growth kinetics of E. coli are described by the curve. Credit: Michał Komorniczak (CC-BY-SA 3.0)

Glucose is the preferred energy source of cells. Jacob and Monod found that if glucose and lactose were presented as food for bacteria, there would be a biphasic growth pattern.

Credit: CNX OpenStax (CC-BY 4.0)

Jacob and Monod came to understand that the glucose would first be utilized (preferred source) and the lactose would be digested after the depletion of glucose. This occurred because under normal situations the bacteria would not have access to lactose and would waste energy by creating enzymes to digest it. The enzyme β-galactosidase, which is responsible for digesting lactose to the monomers galactose and glucose would only be induced under the conditions of low glucose and high lactose. Monod found that when lactose was the sole sugar, the expression of the enzyme β-galactosidase was induced and displayed a monophasic growth with a delay.

The Lac Operon

Jacob and Monod later found that the genes involved in utilizing lactose were clustered together in proximity under a coordinated control mechanism. This became known as the Lac operon.

A schematic of the Lac Operon. LacZ, LacY, and LacA are transcribed as a single mRNA.

The usage of lactose as a source of energy is preferred by bacteria when glucose is not present. In the presence of abundant glucose, it would be a waste of energy and cellular resources to commit to synthesizing the mRNA and the protein for β-galactosidase. Unless lactose is present, a protein binds to a portion of the Lac promoter referred to as the operator. This repressor protein is encoded by another gene (LacI) outside of the gene cluster. Occasionally, the repressor unbinds to the operator and RNA Polymerase is permitted to transcribe the LacZ gene (β-galactosidase), LacY gene (permease), and LacA gene (acetylase). This “leakiness” of expression is important since the permease protein is needed on the surface of the cell to allow lactose into the cell if it is present in the environment. The presence of lactose causes the repressor to fall off the operator to grant RNA pol access to the DNA. When glucose is low, a protein called CAP (Catabolite Activated Protein) binds to the Lac promoter and works as a recruiter of RNA pol. The coordinated effects of CAP activation and Lac Repressor inactivation yield high transcription of the operon.

Credit: G3pro (CC-BY 2.0)

LacI bound to 2 DNA operator sequences.

Credit: SocratesJedi (CC-BY-SA 3.0)

LacZ as a Reporter Gene

pUC19 contains LacZ DNA as a reporter gene to illustrate the presence of the functioning gene. Transcription of this gene is driven by the binding site for the RNA Polymerase subunit called σ factor. The σ factor binding site determines the directionality of the RNA polymerase since there is an option of transcribing in 2 directions. The standard σ factor binding site is often denoted as -35 TTGACA…TATAAT -10 from the transcription initiation.

The multiple cloning site within the plasmid provides a convenient location to shuttle a foreign piece of DNA. When no foreign DNA is inserted to this space, the LacZ gene product β-galactosidase is functional. Disruption of the reading frame for this gene likewise disables the functional product from being translated. By using chemical reporters, the integrity of this gene can be confirmed through enzymatic activity.

Hydrolysis of lactose to galactose and glucose

Two chemical reporters used to reveal the presence of a functioning LacZ are X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside5-bromo-4-chloro-3-indolyl-β-D-galactoside) and ONPG (orthonitrophenol).

X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside) yields a blue color when cleaved by β-galactosidase

ONPG (orthonitrophenol) yields a yellow color upon cleavage by β-galactosidase

As in the case of the Lac operon, the LacI (repressor protein) will occupy the operator. This operator happens to be overlapping the -35 & -10 sequences. In order to fully activate these genes, the Lac repressor must be removed by binding to a lactose analog. In this case, the chemical IPTG (Isopropyl β-D-1-thiogalactopyranoside) is used since it is a non-cleavable analog that will perpetually bind to the Lac repressor.

IPTG

Blue-White Screening

Blue-White Screening reveals a phenotype of transformed bacteria based on the ability of X-Gal conversion by β-lactamase Credit: Stefan Walkowski (CC-BY-SA 4.0)

References

  • JACOB F, MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56.

Biology 171

By the end of this section, you will be able to do the following:

  • List the different steps in prokaryotic transcription
  • Discuss the role of promoters in prokaryotic transcription
  • Describe how and when transcription is terminated

The prokaryotes, which include Bacteria and Archaea, are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles. A bacterial chromosome is a closed circle that, unlike eukaryotic chromosomes, is not organized around histone proteins. The central region of the cell in which prokaryotic DNA resides is called the nucleoid region. In addition, prokaryotes often have abundant plasmids , which are shorter, circular DNA molecules that may only contain one or a few genes. Plasmids can be transferred independently of the bacterial chromosome during cell division and often carry traits such as those involved with antibiotic resistance.

Transcription in prokaryotes (and in eukaryotes) requires the DNA double helix to partially unwind in the region of mRNA synthesis. The region of unwinding is called a transcription bubble. Transcription always proceeds from the same DNA strand for each gene, which is called the template strand . The mRNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate strand , or the coding strand. The only nucleotide difference is that in mRNA, all of the T nucleotides are replaced with U nucleotides ((Figure)). In an RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a DNA double helix.


The nucleotide pair in the DNA double helix that corresponds to the site from which the first 5′ mRNA nucleotide is transcribed is called the +1 site, or the initiation site . Nucleotides preceding the initiation site are denoted with a “-” and are designated upstream nucleotides. Conversely, nucleotides following the initiation site are denoted with “+” numbering and are called downstream nucleotides.

Initiation of Transcription in Prokaryotes

Prokaryotes do not have membrane-enclosed nuclei. Therefore, the processes of transcription, translation, and mRNA degradation can all occur simultaneously. The intracellular level of a bacterial protein can quickly be amplified by multiple transcription and translation events that occur concurrently on the same DNA template. Prokaryotic genomes are very compact, and prokaryotic transcripts often cover more than one gene or cistron (a coding sequence for a single protein). Polycistronic mRNAs are then translated to produce more than one kind of protein.

Our discussion here will exemplify transcription by describing this process in Escherichia coli, a well-studied eubacterial species. Although some differences exist between transcription in E. coli and transcription in archaea, an understanding of E. coli transcription can be applied to virtually all bacterial species.

Prokaryotic RNA Polymerase

Prokaryotes use the same RNA polymerase to transcribe all of their genes. In E. coli, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β, and β‘, comprise the polymerase core enzyme . These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent mRNA molecule and the β‘ subunit binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme .

Prokaryotic Promoters

A promoter is a DNA sequence onto which the transcription machinery, including RNA polymerase, binds and initiates transcription. In most cases, promoters exist upstream of the genes they regulate. The specific sequence of a promoter is very important because it determines whether the corresponding gene is transcribed all the time, some of the time, or infrequently. Although promoters vary among prokaryotic genomes, a few elements are evolutionarily conserved in many species. At the -10 and -35 regions upstream of the initiation site, there are two promoter consensus sequences, or regions that are similar across all promoters and across various bacterial species ((Figure)). The -10 sequence, called the -10 region, has the consensus sequence TATAAT. The -35 sequence has the consensus sequence TTGACA. These consensus sequences are recognized and bound by σ. Once this interaction is made, the subunits of the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding of the DNA template, and several phosphodiester bonds are made. The transcription initiation phase ends with the production of abortive transcripts, which are polymers of approximately 10 nucleotides that are made and released.


View Transcription (video – Walter & Eliza Hall) to see the first part of transcription and the base sequence repetition of the TATA box.

Elongation and Termination in Prokaryotes

The transcription elongation phase begins with the release of the σ subunit from the polymerase. The dissociation of σ allows the core enzyme to proceed along the DNA template, synthesizing mRNA in the 5′ to 3′ direction at a rate of approximately 40 nucleotides per second. As elongation proceeds, the DNA is continuously unwound ahead of the core enzyme and rewound behind it. The base pairing between DNA and RNA is not stable enough to maintain the stability of the mRNA synthesis components. Instead, the RNA polymerase acts as a stable linker between the DNA template and the nascent RNA strands to ensure that elongation is not interrupted prematurely.

Prokaryotic Termination Signals

Once a gene is transcribed, the prokaryotic polymerase needs to be instructed to dissociate from the DNA template and liberate the newly made mRNA. Depending on the gene being transcribed, there are two kinds of termination signals. One is protein-based and the other is RNA-based. Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase encounters a run of G nucleotides on the DNA template and it stalls. As a result, the rho protein collides with the polymerase. The interaction with rho releases the mRNA from the transcription bubble.

Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. The mRNA folds back on itself, and the complementary C–G nucleotides bind together. The result is a stable hairpin that causes the polymerase to stall as soon as it begins to transcribe a region rich in A–T nucleotides. The complementary U–A region of the mRNA transcript forms only a weak interaction with the template DNA. This, coupled with the stalled polymerase, induces enough instability for the core enzyme to break away and liberate the new mRNA transcript.

Upon termination, the process of transcription is complete. By the time termination occurs, the prokaryotic transcript would already have been used to begin synthesis of numerous copies of the encoded protein because these processes can occur concurrently. The unification of transcription, translation, and even mRNA degradation is possible because all of these processes occur in the same 5′ to 3′ direction, and because there is no membranous compartmentalization in the prokaryotic cell ((Figure)). In contrast, the presence of a nucleus in eukaryotic cells precludes simultaneous transcription and translation.


View Transcription (video – ndsuvirtualcell) to see the process of prokaryotic transcription.

Section Summary

In prokaryotes, mRNA synthesis is initiated at a promoter sequence on the DNA template comprising two consensus sequences that recruit RNA polymerase. The prokaryotic polymerase consists of a core enzyme of four protein subunits and a σ protein that assists only with initiation. Elongation synthesizes mRNA in the 5′ to 3′ direction at a rate of 40 nucleotides per second. Termination liberates the mRNA and occurs either by rho protein interaction or by the formation of an mRNA hairpin.

Free Response

If mRNA is complementary to the DNA template strand and the DNA template strand is complementary to the DNA nontemplate strand, then why are base sequences of mRNA and the DNA nontemplate strand not identical? Could they ever be?

DNA is different from RNA in that T nucleotides in DNA are replaced with U nucleotides in RNA. Therefore, they could never be identical in base sequence.

In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes.

Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase stalls at a run of G nucleotides on the DNA template. The rho protein collides with the polymerase and releases mRNA from the transcription bubble. Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. This creates an mRNA hairpin that causes the polymerase to stall right as it begins to transcribe a region rich in A–T nucleotides. Because A–U bonds are less thermostable, the core enzyme falls away.

A fragment of bacterial DNA reads:

3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’

Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

By examining the DNA sequence, we can see that there is a -10 consensus sequence near the 3’ end of the fragment. If we then count downstream, the +1 initiation site is the T immediately following the sequence AAT. This means the DNA fragment that will serve as the template for transcription has the sequence TGATAGAAGCACTCTAC. The mRNA made from this template will have complimentary base pairing with uracil (U) instead of thymine (T). This gives us ACUAUCUUCGUGAGAUG as the transcribed mRNA sequence.

Glossary


Prokaryotic RNA Polymerase

Prokaryotes use the same RNA polymerase to transcribe all of their genes. In E. coli, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β, and β‘ comprise the polymerase core enzyme. These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent “recently born” mRNA molecule and the β‘ binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme.


Prokaryotic RNA Polymerase

Prokaryotes use the same RNA polymerase to transcribe all of their genes. In E. coli, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β, and β‘ comprise the polymerase core enzyme . These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent “recently born” mRNA molecule and the β‘ binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme .


11.2: Prokaryotic Transcription - Biology

In this section, you will explore the following questions:

  • What are the steps, in order, in prokaryotic transcription?
  • How and when is transcription terminated?

Connection for AP ® Courses

During transcription, the enzyme RNA polymerase moves along the DNA template, reading nucleotides in a 3′ to 5′ direction, with U pairing with A and C with G, and assembling the mRNA transcript in a 5′ to 3′ direction. In prokaryotes, mRNA synthesis is initiated at a promoter sequence on the DNA template. Transcription continues until RNA polymerase reaches a stop or terminator sequence at the end of the gene. Termination frees the mRNA and often occurs by the formation of an mRNA hairpin.

Information presented and the examples highlighted in the section support concepts outlined in Big Idea 3 of the AP ® Biology Curriculum Framework. The Learning Objectives listed in the Curriculum Framework provide a transparent foundation for the AP ® Biology course, an inquiry-based laboratory experience, instructional activities, and AP ® Exam questions. A Learning Objective merges required content with one or more of the seven Science Practices.

Big Idea 3 Living systems store, retrieve, transmit and respond to information essential to life processes.
Enduring Understanding 3.A Heritable information provides for continuity of life.
Essential Knowledge 3.A.1 DNA, and in some cases RNA, is the primary source of heritable information.
Science Practice 6.5 The student can evaluate alternative scientific explanations.
Learning Objective 3.1 The student is able to construct scientific explanations that use the structures and mechanisms of DNA and RNA to support the claim that DNA and, in some cases, that RNA are the primary sources of heritable information.

The Science Practice Challenge Questions contain additional test questions for this section that will help you prepare for the AP exam. These questions address the following standards:
[APLO 2.23][APLO 3.28][APLO 4.8][APLO 4.24]

The prokaryotes, which include bacteria and archaea, are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles. A bacterial chromosome is a covalently closed circle that, unlike eukaryotic chromosomes, is not organized around histone proteins. The central region of the cell in which prokaryotic DNA resides is called the nucleoid. In addition, prokaryotes often have abundant plasmids , which are shorter circular DNA molecules that may only contain one or a few genes. Plasmids can be transferred independently of the bacterial chromosome during cell division and often carry traits such as antibiotic resistance.

Transcription in prokaryotes (and in eukaryotes) requires the DNA double helix to partially unwind in the region of mRNA synthesis. The region of unwinding is called a transcription bubble. Transcription always proceeds from the same DNA strand for each gene, which is called the template strand . The mRNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate strand . The only difference is that in mRNA, all of the T nucleotides are replaced with U nucleotides. In an RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a DNA double helix.

The nucleotide pair in the DNA double helix that corresponds to the site from which the first 5' mRNA nucleotide is transcribed is called the +1 site, or the initiation site . Nucleotides preceding the initiation site are given negative numbers and are designated upstream . Conversely, nucleotides following the initiation site are denoted with “+” numbering and are called downstream nucleotides.

Initiation of Transcription in Prokaryotes

Prokaryotes do not have membrane-enclosed nuclei. Therefore, the processes of transcription, translation, and mRNA degradation can all occur simultaneously. The intracellular level of a bacterial protein can quickly be amplified by multiple transcription and translation events occurring concurrently on the same DNA template. Prokaryotic transcription often covers more than one gene and produces polycistronic mRNAs that specify more than one protein.

Our discussion here will exemplify transcription by describing this process in Escherichia coli, a well-studied bacterial species. Although some differences exist between transcription in E. coli and transcription in archaea, an understanding of E. coli transcription can be applied to virtually all bacterial species.

Prokaryotic RNA Polymerase

Prokaryotes use the same RNA polymerase to transcribe all of their genes. In E. coli, the polymerase is composed of five polypeptide subunits, two of which are identical. Four of these subunits, denoted α, α, β, and β' comprise the polymerase core enzyme . These subunits assemble every time a gene is transcribed, and they disassemble once transcription is complete. Each subunit has a unique role the two α-subunits are necessary to assemble the polymerase on the DNA the β-subunit binds to the ribonucleoside triphosphate that will become part of the nascent “recently born” mRNA molecule and the β' binds the DNA template strand. The fifth subunit, σ, is involved only in transcription initiation. It confers transcriptional specificity such that the polymerase begins to synthesize mRNA from an appropriate initiation site. Without σ, the core enzyme would transcribe from random sites and would produce mRNA molecules that specified protein gibberish. The polymerase comprised of all five subunits is called the holoenzyme .

Prokaryotic Promoters

A promoter is a DNA sequence onto which the transcription machinery binds and initiates transcription. In most cases, promoters exist upstream of the genes they regulate. The specific sequence of a promoter is very important because it determines whether the corresponding gene is transcribed all the time, some of the time, or infrequently. Although promoters vary among prokaryotic genomes, a few elements are conserved. At the -10 and -35 regions upstream of the initiation site, there are two promoter consensus sequences, or regions that are similar across all promoters and across various bacterial species (Figure 15.7). The -10 consensus sequence, called the -10 region, is TATAAT. The -35 sequence, TTGACA, is recognized and bound by σ. Once this interaction is made, the subunits of the core enzyme bind to the site. The A–T-rich -10 region facilitates unwinding of the DNA template, and several phosphodiester bonds are made. The transcription initiation phase ends with the production of abortive transcripts, which are polymers of approximately 10 nucleotides that are made and released.

LINK TO LEARNING

View this MolecularMovies animation to see the first part of transcription and the base sequence repetition of the TATA box.


Prokaryotic Termination Signals

Once a gene is transcribed, the prokaryotic polymerase needs to be instructed to dissociate from the DNA template and liberate the newly made mRNA. Depending on the gene being transcribed, there are two kinds of termination signals. One is protein-based and the other is RNA-based. Rho-dependent termination is controlled by the rho protein, which tracks along behind the polymerase on the growing mRNA chain. Near the end of the gene, the polymerase encounters a run of G nucleotides on the DNA template and it stalls. As a result, the rho protein collides with the polymerase. The interaction with rho releases the mRNA from the transcription bubble.

Rho-independent termination is controlled by specific sequences in the DNA template strand. As the polymerase nears the end of the gene being transcribed, it encounters a region rich in C–G nucleotides. The mRNA folds back on itself, and the complementary C–G nucleotides bind together. The result is a stable hairpin that causes the polymerase to stall as soon as it begins to transcribe a region rich in A–T nucleotides. The complementary U–A region of the mRNA transcript forms only a weak interaction with the template DNA. This, coupled with the stalled polymerase, induces enough instability for the core enzyme to break away and liberate the new mRNA transcript.

Upon termination, the process of transcription is complete. By the time termination occurs, the prokaryotic transcript would already have been used to begin synthesis of numerous copies of the encoded protein because these processes can occur concurrently. The unification of transcription, translation, and even mRNA degradation is possible because all of these processes occur in the same 5′ to 3′ direction, and because there is no membranous compartmentalization in the prokaryotic cell ([Figure 3]). In contrast, the presence of a nucleus in eukaryotic cells precludes simultaneous transcription and translation.

Figure 3: Multiple polymerases can transcribe a single bacterial gene while numerous ribosomes concurrently translate the mRNA transcripts into polypeptides. In this way, a specific protein can rapidly reach a high concentration in the bacterial cell.

Visit this BioStudio animation to see the process of prokaryotic transcription.


Transcription - extras for HL

This lesson begins with a review of the process of transcription and the role of RNA polymerase but quickly turns to the control of gene expression using nucleosomes and methylation. Experiments with Drosophila on board the International Space station serve as examples. The final short activity shows how the splicing of mRNA can also affect the proteins produced.Why does RNA synthesis progress in just one direction?

To access the entire contents of this site, you need to log in or subscribe to it.


Structure of an RNA Polymerase II Promoter

Eukaryotic promoters are much larger and more complex than prokaryotic promoters, but both have a TATA box. For example, in the mouse thymidine kinase gene, the TATA box is located at approximately -30 relative to the initiation (+1) site (Figure). For this gene, the exact TATA box sequence is TATAAAA, as read in the 5' to 3' direction on the nontemplate strand. This sequence is not identical to the E. coli TATA box, but it conserves the A–T rich element. The thermostability of A–T bonds is low and this helps the DNA template to locally unwind in preparation for transcription.

A generalized promoter of a gene transcribed by RNA polymerase II is shown. Transcription factors recognize the promoter. RNA polymerase II then binds and forms the transcription initiation complex.

Art Connection

Eukaryotic mRNA contains introns that must be spliced out. A 5' cap and 3' poly-A tail are also added.

A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?


Prokaryotic Transcription

The prokaryotes, which include Bacteria and Archaea, are mostly single-celled organisms that, by definition, lack membrane-bound nuclei and other organelles. A bacterial chromosome is a closed circle that, unlike eukaryotic chromosomes, is not organized around histone proteins. The central region of the cell in which prokaryotic DNA resides is called the nucleoid region. In addition, prokaryotes often have abundant plasmids, which are shorter, circular DNA molecules that may only contain one or a few genes. Plasmids can be transferred independently of the bacterial chromosome during cell division and often carry traits such as those involved with antibiotic resistance.

Transcription in prokaryotes (and in eukaryotes) requires the DNA double helix to partially unwind in the region of mRNA synthesis. The region of unwinding is called a transcription bubble. Transcription always proceeds from the same DNA strand for each gene, which is called the template strand . The mRNA product is complementary to the template strand and is almost identical to the other DNA strand, called the nontemplate strand , or the coding strand. The only nucleotide difference is that in mRNA, all of the T nucleotides are replaced with U nucleotides (Figure). In an RNA double helix, A can bind U via two hydrogen bonds, just as in A–T pairing in a DNA double helix.

Messenger RNA is a copy of protein-coding information in the coding strand of DNA, with the substitution of U in the RNA for T in the coding sequence. However, new RNA nucleotides base pair with the nucleotides of the template strand. RNA is synthesized in its 5'-3' direction, using the enzyme RNA polymerase. As the template is read, the DNA unwinds ahead of the polymerase and then rewinds behind it.


Blue-White Screening

Transformed bacteria containing a plasmid will be antibiotic resistant and survive the selection process. In the case of many vectors, the MCS is within a gene for LacZ. Therefore, effectively inserting a new piece of DNA into this MCS would disrupt the functionality of the &beta-galactosidase gene. Supplying X-gal on the plate will then reveal which clonal colonies contain the unadulterated plasmid vector and those which have recombinant insertions.

Blue-White Screening reveals a phenotype of transformed bacteria based on the ability of X-Gal conversion by &beta-lactamase Credit: Stefan Walkowski (CC-BY-SA 4.0)


Watch the video: ΑΝΤΙΓΡΑΦΗ DNA 1 - DNA replication 1 (May 2022).